Ćwiczenie 2 Amplifikacja genu kodującego Czerwoną Proteinę Fluoryzującą



Pobieranie 13.16 Kb.
Data19.06.2016
Rozmiar13.16 Kb.
Ćwiczenie 2

Amplifikacja genu kodującego Czerwoną Proteinę Fluoryzującą

Trawienie DNA wektora plazmidowego enzymem restrykcyjnym
Materiały

- DNA plazmidu pDsRed2;

- DNA plazmidu pUC19;

- enzym restrykcyjny SmaI (EURx);

- roztwór buforowy do trawienia enzymem restrykcyjnym (EURx);

- 10x PCR bufor HyperNova;

- 50 mM MgCl2;

- trifosforany deoksyrybonukleozydów (dNTPs): 2 mM dATP, 2 mM dCTP, 2 mM dGTP, 2

mM dTTP;

- jałowa woda dejonizowana;

- startery:

DsRed2A: 5’ CGCATATGGCCTCCTCCGAGAACG 3’ 10 μM,

DsRed2B: 5’ GAAGCTTCTACAGGAACAGGTGGTGGCG 3’ 10 μM;

- polimeraza DNA HyperNova.


Wykonanie

I. Amplifikacja genu kodującego Czerwoną Proteinę Fluoryzującą

Skład mieszaniny reakcyjnej:

- DNA matrycowe pDsRed2

0,5 μl,

- starter DsRed2A

1,0 μl,

- starter DsRed2B

1,0 μl,

- 10x PCR bufor

5,0 μl,

- MgCl2

3,0 μl,

- dNTPs

5,0 μl,

- polimeraza DNA HyperNova

0,5 μl,

- jałowa woda dejonizowana

34,0 μl.


Profil temperaturowo-czasowy reakcji PCR:

Temperatura [°C]

Czas [s]

Liczba cykli

93

120




93

60

30


60

60

72

60

72

300




4

36000





Każdy zespół przygotowuje 2 mieszaniny reakcyjne.
II. Trawienie DNA wektora plazmidowego enzymem restrykcyjnym

Skład mieszaniny reakcyjnej:

- DNA plazmidu pUC19

10 μl,

- Roztwór buforowy

3 μl,

- SmaI

1 μl,

- jałowa woda dejonizowana

16 μl.

Reakcję trawienia DNA prowadzić w 25°C przez 1,5 godziny.
Każdy zespół przygotowuje 2 mieszaniny reakcyjne.
Literatura

  1. J. Kur „Podstawy inżynierii genetycznej. Teoria, ćwiczenia, testy.” Wydawnictwo PG, 1994.

  2. B. Zalewska-Piątek, M. Olszewski, R. Piątek, S. Milewski, J. Kur „Biologia molekularna. Ćwiczenia laboratoryjne.” Wydawnictwo PG, 2009.





©snauka.pl 2019
wyślij wiadomość

    Strona główna
Komunikat prasowy
przedmiotu zamówienia
najkorzystniejszej oferty
Informacja prasowa
wyborze najkorzystniejszej
warunków zamówienia
istotnych warunków
sprawie powołania
Regulamin konkursu
udzielenie zamówienia
przetargu nieograniczonego
zamówienia publicznego
Nazwa przedmiotu
Specyfikacja istotnych
modułu kształcenia
Rozporządzenie komisji
studia stacjonarne
wyborze oferty
Zapytanie ofertowe
Szkolny zestaw
Ochrony rodowiska
ramach projektu
prasowy posiedzenie
trybie przetargu
obwodowych komisji
zagospodarowania przestrzennego
komisji wyborczych
komisji wyborczej
Program konferencji
Wymagania edukacyjne
Lista kandydatów
szkoły podstawowej
która odbyła
Województwa ląskiego
Decyzja komisji
przedmiotu modułu
poszczególne oceny
Sylabus przedmiotu
szkół podstawowych
semestr letni
Postanowienia ogólne
przedsi biorców
produktu leczniczego
Karta przedmiotu
Scenariusz lekcji
Lista uczestników
Program nauczania
Projekt współfinansowany
Informacje ogólne
biblioteka wojewódzka
semestr zimowy