Strona główna

Sprawdzian a Test podsumowujący dział I podstawy genetyki


Pobieranie 104.14 Kb.
Data19.06.2016
Rozmiar104.14 Kb.
Sprawdzian a

Test podsumowujący dział I



Podstawy genetyki

Masz przed sobą test składający się z 15 zadań.

Przy każdym poleceniu podano liczbę punktów możliwych do uzyskania.

Na rozwiązanie testu masz 40 minut.



1. Zaznacz punkt, w którym podano przykład cechy niedziedzicznej. (0–1)

A) Niebieskie oczy. B) Opalenizna. C) Przylegające uszy. D) Jasne włosy.


2. Przyporządkuj typom podziałów komórkowych przykłady sytuacji, w których one zachodzą. (0–2)

A) mejoza 1. zabliźnianie się ran

2. powstawanie plemników w jądrach

B) mitoza 3. wytwarzanie zarodników u grzybów i niektórych roślin

4. podziały komórkowe w stożku wzrostu korzenia

A) 3/2 B) 1/4
3. Uzupełnij tabelę, wpisując w wolne rubryki odpowiednią liczbę chromosomów. (0–2)


Nazwa organizmu

Liczba chromosomów

w komórkach somatycznych

Liczba chromosomów w gametach

łabędź

76

76/2= 38

mysz

20*2= 40

20

4. Przyporządkuj terminom ich wyjaśnienia. (0–2)

A) fenotyp 1. Zestaw wszystkich chromosomów w komórce somatycznej.

B) genotyp 2. Wszystkie cechy organizmu, które można zaobserwować.

C) autosomy 3. Wszystkie geny danego organizmu.

D) kariotyp 4. Wszystkie chromosomy z wyjątkiem chromosomów płci.

A) 2 B) 3 C) 4 D) 1

5. U groszku gładka powierzchnia nasion jest uwarunkowana przez dominujący allel A, natomiast (0–1)

pomarszczona powierzchnia nasion – przez allel recesywny a. Skrzyżowano homozygotę dominującą z homozygotą recesywną. Określ, w której kolumnie podano prawidłowy genotyp i fenotyp pokolenia F1.



Nasiona

Sytuacja I

Sytuacja II

Sytuacja III

genotyp

AA

Aa

aa

fenotyp

gładkie

gładkie

pomarszczone

Genotyp i fenotyp pokolenia F1 prawidłowo określa sytuacja II.
6. Groszek może mieć nasiona żółte lub zielone. W wyniku krzyżowania roślin o zielonych (0–4)

nasionach otrzymujemy zawsze nasiona zielone. Natomiast kiedy krzyżujemy roślinę o nasionach żółtych z rośliną o nasionach zielonych – uzyskujemy różne wyniki. Zostały one zapisane w tabeli. Wypełnij jej brakujące rubryki, wpisując odpowiednie genotypy. Określ, który allel jest dominujący (B), a który – recesywny (b).




Nr próby

Roślina I

Roślina II

Pokolenie (F1)

fenotyp nasion

genotyp

fenotyp nasion

genotyp

fenotyp nasion

genotyp

1.

zielone

bb

zielone

bb

zielone

bb

2.

żółte

BB

zielone

bb

żółte

Bb

3.

żółte

Bb

zielone

bb

żółte i zielone

Bb oraz bb

Allel dominujący nadaje żółtą barwę nasion, a allel recesywny – zieloną barwę.


7. Przedstaw, w jaki sposób dziedziczy się płeć u człowieka. W tym celu wypełnij krzyżówkę (0–3)

genetyczną. Napisz, jakie jest prawdopodobieństwo urodzenia się dziewczynki.

PS. Dziedziczenie płci to inaczej ,,lygeus’’.


ON

ONA

nX


nY

nX


2nXX

2nXY

nX


2nXX

2nXY

GENOTYP:

ON: 50% XY

ONA: 50% XX



Prawdopodobieństwo urodzenia się dziewczynki wynosi 50%
8. Zaznacz punkty charakteryzujące DNA. Wpisz znak X w odpowiednie kwadraty. (0–2)
• W jego nukleotydach występują zasady azotowe: adenina, cytozyna, guanina i uracyl. F

• Jest dwuniciowy. P

• W jego nukleotydach występują zasady azotowe: adenina, tymina, cytozyna i guanina. P

• Jest jednoniciowy. F


9. W pewnej cząsteczce DNA stwierdzono, że tymina stanowi 35% wszystkich zasad. (0–1)

Zaznacz punkt, który zawiera prawidłowy zapis procentowej zawartości pozostałych trzech

zasad w tej cząsteczce DNA.

A) Guanina 35%, adenina 15%, cytozyna 15%. A------T (35%) Skoro adenina leży tuż obok tyminy



B) Guanina 15%, adenina 35%, cytozyna 15%. C----G jej procent jest taki sam czyli też

C) Guanina 25%, adenina 35%, cytozyna 25%. 35%). Pozostaje nam cytozyna i

D) Guanina 15%, adenina 15%, cytozyna 35%. guanina. Obliczając:

35%*2=70%

100%-70%=30%

Tym 30% jest procent cytozyny i

guaniny, więc żeby je obliczyć

dzielimy je na dwa: 30%:2=15%.
10. W poniższych zdaniach wykreśl wyrazy tak, aby opis procesu powstawania białek był prawidłowy. (0–2)
Aby powstało białko, informacja genetyczna jest realizowana w dwóch etapach. Pierwszy etap zachodzi w jądrze komórkowym / cytoplazmie (jest to tzw. ,,transkrypcja’’- mój dopisek- nie obrazisz się?) i polega na przepisaniu informacji zawartej w DNA / tRNA na mRNA. Drugi etap zachodzi w jądrze komórkowym / cytoplazmie (tu zaczyna się już translacja) i polega na przetłumaczeniu kolejności nukleotydów z mRNA / rRNA na kolejność aminokwasów tworzących białko.
11. Zaznacz punkt, w którym wymieniono wyłącznie choroby spowodowane mutacjami genowymi. (01)
A) Fenyloketonuria, anemia sierpowata, mukowiscydoza, hemofilia.

B) Daltonizm, bielactwo, pląsawica Huntingtona, zespół Downa (choroba chromosomalna- trisomia chromosomu 21).

C) Anemia sierpowata, grypa, fenyloketonuria, bielactwo.

D) Bielactwo, daltonizm, zespół kociego krzyku (tzw. ,,cri du chat’’ zresztą choroba chromosomalna), mukowiscydoza.


12. Na wykresie podano częstość występowania zespołu Downa (0–2)

w zależności od wieku matki. Oceń prawdziwość zdań dotyczących ryzyka wystąpienia tej choroby, wpisując w kwadraty literę „P”, gdy zdanie jest prawdziwe, lub literę „F”, gdy jest ono fałszywe.


• Najmniejsze prawdopodobieństwo urodzenia dziecka z zespołem Downa występuje u matek będących po 40 roku życia. F

• Wiek matki nie wpływa na ryzyko wystąpienia zespołu Downa. F

• Największe prawdopodobieństwo urodzenia dziecka z zespołem Downa występuje F


u matek będących po 40 roku życia.

• Wiek matki jest ważnym czynnikiem wpływającym na ryzyko wystąpienia zespołu P


Downa.

1
gęsty las

otwarta przestrzeń

nadmorska wydma
3.
Na ilustracjach przedstawiono i opisano różne rodzaje fenotypu sosny zwyczajnej. Skreśl (0–3)

fałszywą informację w podanym niżej zadaniu, a następnie zaznacz zdania charakteryzujące ten typ zmienności. Wpisz znak X w odpowiednie kwadraty.

Na ilustracjach przedstawiono przykład zmienności genetycznej / środowiskowej.
• Jest ona wynikiem oddziaływania środowiska na osobnika. P

• Cechy są przekazywane z pokolenia na pokolenie. F

• Jest ona wynikiem łączenia się gamet różnych osobników. F

• Cechy nie są przekazywane z pokolenia na pokolenie. P


14. Tabela przedstawia genotypy i fenotypy sześciorga dzieci. Które z nich mogłyby być (0–3)

potomstwem pary: mama heterozygota o grupie krwi A i tata o grupie krwi AB? Uzupełnij krzyżówkę genetyczną, a następnie wstaw znak X w odpowiedniej rubryce tabeli.




on ona

IA

IB


IA

IAIA

IAIB

i


IAi

IBi




Imię dziecka

Grupa krwi

Genotyp

Tak

Nie

Justyna

A

IAIA

X




Piotr

B

IBi

X




Agata

AB

IA IB

X




Paweł

A

IAi

X




Dorota

B

IB IB




X

Maria

0

i i




X
Sorki, że mi te tabele się najechaly. 

15. Zadanie na ocenę celującą (0–5)
Sekwencja aminokwasów początkowego odcinka jednego z łańcuchów prawidłowej hemoglobiny jest następująca: walina, histydyna, leucyna, treonina, prolina, kwas glutaminowy, kwas glutaminowy, lizyna. W łańcuchu hemoglobiny u chorych na anemię sierpowatą szósty aminokwas został zamieniony na walinę.








Tabela kodu genetycznego







1

U

C

A

G

3

U

UUU Fenyloalanina

UCU Seryna

UAU Tyrozyna

UGU Cysteina

U




UUC Fenyloalanina

UCC Seryna

UAC Tyrozyna

UGC Cysteina

C




UUA Leucyna

UCA Seryna

UAA (STOP)

UGA (STOP)

A




UUG Leucyna

UCG Seryna

UAG (STOP)

UGG Tryptofan

G

C

CUU Leucyna

CCU Prolina

CAU Histydyna

CGU Arginina

U




CUC Leucyna

CCC Prolina

CAC Histydyna

CGC Arginina

C




CUA Leucyna

CCA Prolina

CAA Glutamina

CGA Arginina

A




CUG Leucyna

CCG Prolina

CAG Glutamina

CGG Arginina

G

A

AUU Izoleucyna

ACU Treonina

AAU Asparagina

AGU Seryna

U




AUC Izoleucyna

ACC Treonina

AAC Asparagina

AGC Seryna

C




AUA Izoleucyna

ACA Treonina

AAA Lizyna

AGA Arginina

A




AUG Metionina (START)

ACG Treonina

AAG Lizyna

AGG Arginina

G

G

GUU Walina

GCU Alanina

GAU Kwas asparaginowy

GGU Glicyna

U




GUC Walina

GCC Alanina

GAC Kwas asparaginowy

GGC Glicyna

C




GUA Walina

GCA Alanina

GAA Kwas glutaminowy

GGA Glutamina

A




GUG Walina

GCG Alanina

GAG Kwas glutaminowy

GGG Glicyna

G

Posługując się zamieszczoną powyżej tabelą, wykonaj polecenia. Używaj zawsze pierwszego kodonu

dla danego aminokwasu.
a) Zapisz sekwencję nukleotydów mRNA łańcucha prawidłowej hemoglobiny.

CAAGUAAAUUGAGGAGUUGUUUUU

b) Zapisz sekwencję nukleotydów mRNA łańcucha hemoglobiny u osób chorych na anemię sierpowatą.



CAAGUAAAUUGAGGACAAGUUUUU

c) Zapisz sekwencję nukleotydów DNA komplementarną do zapisanego przez Ciebie powyżej łańcucha mRNA prawidłowej hemoglobiny.



GUUCAUUUAACUCCUCAACAAAAA

d) Zapisz sekwencję nukleotydów DNA komplementarną do zapisanego przez Ciebie powyżej łańcucha mRNA hemoglobiny u osób chorych na anemię sierpowatą.



GUUCAUUUAACUCCUGUUCAAAAA

e) Porównaj sekwencje obu DNA. Napisz, jaka zmiana zaszła w materiale genetycznym u osoby chorej. Podaj nazwę tego typu zmian.



Mutacją, która zaszła w tym wypadku jest zamiana białka- kwasu glutaminowego- na walinę. Taki typ mutacji nazywamy SUBSTYTUCJĄ.


©snauka.pl 2016
wyślij wiadomość